August 26, 2020

Evaluation of RealStar Reverse Transcription-Polymerase Chain Reaction Kits

By Martin

Analysis of RealStar Reverse Transcription-Polymerase Chain Response Kits for Filovirus Detection within the Laboratory and Area.

Prognosis of Ebola virus (EBOV) illness (EVD) requires laboratory testing.

The RealStar Filovirus Display screen reverse transcription-polymerase chain response (RT-PCR) equipment and the derived RealStar Zaire Ebolavirus RT-PCR equipment had been validated utilizing in vitro transcripts, supernatant of contaminated cell cultures, and medical specimens from sufferers with EVD.

The Filovirus Display screen equipment detected EBOV, Sudan virus, Taï Forest virus, Bundibugyo virus, Reston virus, and Marburg virus and differentiated between the genera Ebolavirus and Marburgvirus The quantity of filovirus RNA that might be detected with a likelihood of 95% ranged from 11 to 67 RNA copies/response on a LightCycler 480 II.

The Zaire Ebolavirus equipment is predicated on the Filovirus Display screen equipment however was optimized for detection of EBOV. It has an improved signal-to-noise ratio at low EBOV RNA concentrations and is considerably extra delicate than the Filovirus equipment. Each kits present considerably decrease analytical sensitivity on a SmartCycler II.

Scientific analysis revealed that the SmartCycler II, in contrast with different real-time PCR platforms, decreases the medical sensitivity of the Filovirus Display screen equipment to diagnose EVD at an early stage.

The Filovirus Display screen equipment detects all human-pathogenic filoviruses with good analytical sensitivity if carried out on an acceptable real-time PCR platform. Excessive analytical sensitivity is vital for early prognosis of EVD.

sebov-detection

Human Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Anti-CD163
DB-045-0.1	DB Biotech	100 μl	EUR 212
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-CD163
DB-045-0.2	DB Biotech	200 μl	EUR 298
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-CD163
DB-045-0.5	DB Biotech	500 μl	EUR 384
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-CD163
DB-045-1	DB Biotech	1 ml	EUR 613
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-CD163
DB-045-RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD163
DB-045-RTU-7	DB Biotech	7 ml	EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD163
DB045RTU-15	DB Biotech	15 ml	EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD163
DB045RTU-7	DB Biotech	7 ml	EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Mouse Cluster Of Differentiation (CD163) ELISA Kit
DLR-CD163-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation (CD163) in samples from serum, plasma or other biological fluids.

Mouse Cluster Of Differentiation (CD163) ELISA Kit
DLR-CD163-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation (CD163) in samples from serum, plasma or other biological fluids.

Rat Cluster Of Differentiation (CD163) ELISA Kit
DLR-CD163-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation (CD163) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Cluster Of Differentiation (CD163) ELISA Kit
DLR-CD163-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation (CD163) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Mouse Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Rat Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Anti-CD163 Antibody
A00812-1	BosterBio	100ug/vial	EUR 334

Anti-CD163 Antibody
PA1874	BosterBio	100ug/vial	EUR 294

Anti-CD163 Antibody
PA1874-1	BosterBio	100ug/vial	EUR 334

Anti-CD163 Antibody
STJ500423	St John's Laboratory	100 µg	EUR 476

Anti-CD163 Antibody
STJ500424	St John's Laboratory	100 µg	EUR 476

Anti-CD163 antibody
STJ110681	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.

Anti-CD163 antibody
STJ160082	St John's Laboratory	1 mL C	EUR 941

Anti-CD163 antibody
STJ16100302	St John's Laboratory	100 µg	EUR 720

Anti-CD163 antibody
STJ16100324	St John's Laboratory	1 mL	EUR 979

Anti-CD163 antibody
STJ180301	St John's Laboratory	0.1 ml	EUR 215

Anti-CD163 antibody
STJ190009	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Mouse monoclonal to CD163 (AS1A1)

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

anti- CD163/M130 Antibody
FNab09771	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:300-1:1000 Immunogen: CD163 Uniprot ID: Q86VB7 Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Neuroscience, Stem Cells
Description: Antibody raised against CD163/M130

Anti-CD163/M130 Antibody
A00812	BosterBio	100ul	EUR 397
Description: Rabbit IgG polyclonal antibody for Scavenger receptor cysteine-rich type 1 protein M130 (CD163) detection.tested for IF, IHC, WB in Human, Mouse, Rat. Various direct flourescent conjugates are available for FCM upon request. Please contact us for details.

Anti-Hu CD163 Purified
11-645-C025	ExBio	0.025 mg	EUR 99

Anti-Hu CD163 Purified
11-645-C100	ExBio	0.1 mg	EUR 158

Anti-Hu CD163 APC
1A-645-T025	ExBio	25 tests	EUR 140

Anti-Hu CD163 APC
1A-645-T100	ExBio	100 tests	EUR 240

Anti-Hu CD163 PE
1P-645-T025	ExBio	25 tests	EUR 140

Anti-Hu CD163 PE
1P-645-T100	ExBio	100 tests	EUR 240

Anti-CD163/M130 antibody
PAab09771	Lifescience Market	100 ug	EUR 355

Anti-CD163 Antibody BIOTIN
STJ500425	St John's Laboratory	100 µg	EUR 586

Anti-CD163 Antibody FITC
STJ500426	St John's Laboratory	100 µg	EUR 586

Anti-CD163 Antibody BIOTIN
STJ500427	St John's Laboratory	100 µg	EUR 586

Anti-CD163 Antibody FITC
STJ500428	St John's Laboratory	100 µg	EUR 586

Human CD163 antigen(CD163)ISA kit
GA-E0263HM-48T	GenAsia Biotech	48T	EUR 289

Human CD163 antigen(CD163)ISA kit
GA-E0263HM-96T	GenAsia Biotech	96T	EUR 466

human CD163 antigen,CD163 LISA kit
201-12-0247	SunredBio	96 tests	EUR 440
This CD163 antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human CD163 antigen(CD163)ISA kit
QY-E05066	Qayee Biotechnology	96T	EUR 361

Mouse Anti Human Cd163 Monoclonal Antibody
CABT-47162MH	Creative Diagnostics	25 µg	EUR 372

Mouse Anti Human Cd163 Monoclonal Antibody
CABT-47163MH	Creative Diagnostics	0.2 mg	EUR 881

Anti-CD163 Rabbit Monoclonal Antibody
M00812	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal CD163 Antibody. Validated in IP, WB and tested in Human.

Anti-Hu CD163 PE-Cy7
T7-645-T025	ExBio	25 tests	EUR 154

Anti-Hu CD163 PE-Cy7
T7-645-T100	ExBio	100 tests	EUR 268

Anti-Hu CD163 PerCP-Cy5.5
T9-645-T025	ExBio	25 tests	EUR 196

Anti-Hu CD163 PerCP-Cy5.5
T9-645-T100	ExBio	100 tests	EUR 352

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

Porcine CD163 antigen,CD163 LISA kit
GA-E0045PC-48T	GenAsia Biotech	48T	EUR 364

Porcine CD163 antigen,CD163 LISA kit
GA-E0045PC-96T	GenAsia Biotech	96T	EUR 590

Canine CD163 antigen(CD163 LISA kit
GA-E0062CN-48T	GenAsia Biotech	48T	EUR 402

Canine CD163 antigen(CD163 LISA kit
GA-E0062CN-96T	GenAsia Biotech	96T	EUR 684

Mouse Anti Rat Cd163 Monoclonal Antibody
DMABT-47170MR	Creative Diagnostics	0.25 mg	EUR 741

Mouse Anti Rat Cd163 Monoclonal Antibody
DMABT-47171MR	Creative Diagnostics	0.1 mg	EUR 559

CD163 siRNA
20-abx910930	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CD163 siRNA
20-abx910931	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CD163 Antibody
20-abx242956	Abbexa	EUR 467.00 EUR 328.00	100 ul 50 ul
Shipped within 1-2 weeks.

CD163 Antibody
ABD8235	Lifescience Market	100 ug	EUR 438

CD163 Antibody
37157-100ul	SAB	100ul	EUR 252

CD163 Antibody
49553-100ul	SAB	100ul	EUR 333

CD163 Antibody
49553-50ul	SAB	50ul	EUR 239

CD163 antibody
10R-6496	Fitzgerald	100 ug	EUR 203
Description: Mouse monoclonal CD163 antibody

CD163 antibody
10R-CD163aRT	Fitzgerald	250 ug	EUR 716
Description: Mouse monoclonal CD163 antibody

CD163 Antibody
DF8235	Affbiotech	200ul	EUR 304
Description: CD163 Antibody detects endogenous levels of total CD163.

CD163 Antibody
1-CSB-PA969205	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CD163 Antibody
1-CSB-PA801238LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Cd163 Antibody
1-CSB-PA650452LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd163. Recognizes Cd163 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

Mouse Anti-Human CD163 monoclonal antibody, clone JID274
CABT-L2938-100uL500uL	Creative Diagnostics	100 uL, 500 uL	EUR 502

Anti-Human CD163 DyLight® 488 conjugated Antibody
A00812-Dyl488	BosterBio	100ug/vial	EUR 344

Anti-Human CD163 DyLight® 550 conjugated Antibody
A00812-Dyl550	BosterBio	100ug/vial	EUR 344

Human CD163 ELISA Kit
ELA-E1726h	Lifescience Market	96 Tests	EUR 824

Human CD163 shRNA Plasmid
20-abx956176	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CD163 ELISA Kit
LF-EK50890	Abfrontier	1Ã—96T	EUR 648

Human CellExp? CD163, Human recombinant
9226-10	Biovision		EUR 305

Human CellExp? CD163, Human recombinant
9226-50	Biovision		EUR 773

Mouse Anti Pig Cd163 Monoclonal Antibody,FITC
CABT-47164MP	Creative Diagnostics	0.1 mg	EUR 881

Mouse Anti Pig Cd163 Monoclonal Antibody,RPE
CABT-47166MP	Creative Diagnostics	100 TEST	EUR 715

Mouse Anti Rat Cd163 Monoclonal Antibody,Biotin
DMABT-47168MR	Creative Diagnostics	0.1 mg	EUR 881

Analysis of Ebola Virus Inhibitors for Drug Repurposing.

A systematic display of FDA-approved medicine was carried out to establish compounds with in vitro antiviral actions in opposition to Ebola virus (EBOV). Compounds lively (>50% viral inhibition and <30% mobile toxicity) at a single focus had been examined in dose-response assays to quantitate the antiviral actions in replication and viral entry assays in addition to cytotoxicity within the Vero cell line used to conduct these assays.

On the idea of the accepted human dosing, toxicity/tolerability, and pharmacokinetic knowledge, seven of those in vitro hits from completely different pharmacological lessons (chloroquine (CQ), amiodarone, prochlorperazine, benztropine, azithromycin, chlortetracycline, and clomiphene) had been evaluated for his or her in vivo efficacy at a single dose and had been administered by way of both intraperitoneal (ip) or oral route.

Initially, azithromycin (100 mg/kg, twice day by day, ip), CQ (90 mg/kg, twice day by day, ip), and amiodarone (60 mg/kg, twice day by day, ip) demonstrated vital will increase in survival within the mouse mannequin. After repeat analysis, solely CQ was discovered to reproducibly give vital efficacy within the mouse mannequin with this dosing routine.

Azithromycin and CQ had been additionally examined in a guinea pig mannequin of EBOV an infection over a variety of doses, however not one of the doses elevated survival, and drug-related toxicity was noticed at decrease doses than within the mouse. These outcomes present the advantages and particular challenges related to drug repurposing and spotlight the necessity for cautious analysis of accepted medicine as quickly deployable countermeasures in opposition to future pandemics.

The analysis of seven business real-time PCR kits for Zaire ebolavirus utilizing virus-like particle-encapsulated EBOV RNA.

A number of Chinese language business real-time PCR kits for Zaire ebolavirus have been developed after the Ebola outbreak and utilized by Chinese language medical groups in West Africa.

With the intention to know the important efficiency indicators of those kits, analytical sensitivity and precision had been evaluated with virus-like particle (VLP)-encapsulated EBOV RNA.

The limit of detection (LOD) and the precision had been accomplished with a collection of VLPs. The utmost and minimal of LOD was acquired by ZJ BioTech and Daan gene, respectively. For precision, the entire detection outcomes had been <5% besides the utmost 5.17%. Amongst them, Puruikang, Daan gene, Sansure, ZJ BioTech, and Huada demonstrated superior reproducibility.

Total, the necessities of LOD <1000 copies/mL and coefficient of variation <5% might be happy by all kits besides Kehua. In the meantime, it is possible for VLPs as a substitute of positive samples in assay analysis.

GRO / KC (CXCL1) Protein
20-abx260684	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

GRO / KC (CXCL1) Protein
20-abx261870	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

GRO1/KC Mouse Recombinant Protein (CXCL1)
PROTP12850-1	BosterBio	Regular: 20ug	EUR 317
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.

Recombinant Mouse (E.Coli) GRO/KC (CXCL1)
RP-1037	Alpha Diagnostics	5 ug	EUR 164

GRO/KC (CXCL1), Rat Recombinant
P1288-25	Biovision		EUR 370

GRO/KC (CXCL1), Rat Recombinant
P1288-5	Biovision		EUR 175

Recombinant Murine KC (CXCL1) Protein
PROTP12850-2	BosterBio	20ug	EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

GRO, KC, CXCL1, rRtGRO, rat
RC352-12	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag
PROTP12850	BosterBio	Regular: 20ug	EUR 317
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)
RC332-12	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Rat GRO/KC (CXCL1) Protein
PROTP14095-1	BosterBio	25ug	EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

Rat CXCL1/CINC-1/KC ELISA Kit
RK00196	Abclonal	96 Tests	EUR 521

KC protein (Mouse)
30R-AK001	Fitzgerald	20 ug	EUR 273
Description: Purified recombinant Mouse KC protein

Anti-CXCL1 antibody
STJ72026	St John's Laboratory	100 µg	EUR 260

Anti-CXCL1 antibody
STJ28366	St John's Laboratory	100 µl	EUR 277
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Rabbit Anti Mouse Cxcl1 Polyclonal Antibody
CPBT-65100RM	Creative Diagnostics	0.1 mg	EUR 881

KC antibody
70R-KR006	Fitzgerald	50 ug	EUR 273
Description: Affinity purified Rabbit polyclonal KC antibody

KC Antibody
5211-100	Biovision		EUR 376

KC Antibody
5212-100	Biovision		EUR 392

KC Antibody
5212-30T	Biovision		EUR 146

KC antibody
20R-1786	Fitzgerald	100 ug	EUR 651
Description: Rabbit polyclonal KC antibody

KC antibody
70R-12297	Fitzgerald	100 ug	EUR 527
Description: Rabbit polyclonal KC antibody

KC antibody
70R-12298	Fitzgerald	100 ug	EUR 492
Description: Rabbit polyclonal KC antibody

anti-7-ketocholesterol (7-KC) (35A)
LF-MA90006	Abfrontier	20 ug	EUR 1025
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

anti-7-ketocholesterol (7-KC) (35A)
LF-MA90007	Abfrontier	100 ug	EUR 2725
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

Anti-GRO alpha/Cxcl1 Antibody
A00533	BosterBio	100ug/vial	EUR 294

Anti-GRO alpha/CXCL1 Antibody
PA1760	BosterBio	100ug/vial	EUR 294

Polyclonal KC Antibody
APR16969G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:

KC 12291 hydrochloride
B7332-10	ApexBio	10 mg	EUR 373

KC 12291 hydrochloride
B7332-50	ApexBio	50 mg	EUR 1363

KC Blocking Peptide
33R-11041	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298

KC Blocking Peptide
5212BP-50	Biovision		EUR 153

GRO-alpha/CXCL1, Mouse
HY-P7188	MedChemExpress	50ug	EUR 533

Mouse CXCL1 ELISA Kit
55R-1741	Fitzgerald	1 kit	EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

Mouse CXCL1 shRNA Plasmid
20-abx970673	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CXCL1 siRNA
20-abx901350	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CXCL1/GRO
E21-597	EnoGene	10ug	EUR 343

CXCL1/GRO
EF012822	Lifescience Market	96 Tests	EUR 689

CXCL1 siRNA
20-abx913248	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CXCL1 siRNA
20-abx913249	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CXCL1 Antibody
43679-100ul	SAB	100ul	EUR 252

CXCL1 protein
30R-3156	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant CXCL1 protein

CXCL1 Antibody
33054-100ul	SAB	100ul	EUR 252

CXCL1 antibody
70R-14297	Fitzgerald	100 ug	EUR 327
Description: Affinity purified Rabbit polyclonal CXCL1 antibody

CXCL1 antibody
70R-10502	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal CXCL1 antibody

CXCL1 antibody
70R-15473	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 antibody
70R-16681	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 Antibody
1-CSB-PA006239GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CXCL1 Antibody
1-CSB-PA009036	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

Cxcl1 Antibody
1-CSB-PA09217A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CXCL1 Antibody
1-CSB-PA06097A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

pEGFP- CXCL1
PVT10178	Lifescience Market	2 ug	EUR 301

Rabbit Anti Rat Cxcl1 Polyclonal Antibody
CPBT-65101RR	Creative Diagnostics	0.1 mg	EUR 881

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

KiloGreen 2X qPCR MasterMix-iCycler
MasterMix-KC	ABM	4 x 1.25 ml - 500 reactions (20 ul)	EUR 140

GRO/KC, murine recombinant
4210-100	Biovision		EUR 773

GRO/KC, murine recombinant
4210-1000	Biovision		EUR 3856

GRO/KC, murine recombinant
4210-20	Biovision		EUR 256

ELISA kit for Mouse CXCL1
EK5299	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse CXCL1 PicoKine ELISA Kit
EK0723	BosterBio	96 wells	EUR 456
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.

CXCL1 protein (Mouse) (His tag)
80R-3368	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

CXCL1 protein (Mouse) (His tag)
80R-3439	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

Mouse CXCL1 Detection Assay Kit
6725	Chondrex	1 kit	EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit

Mouse CXCL1/GROÎ± ELISA kit
LF-EK50473	Abfrontier	1Ã—96T	EUR 648

Cxcl1 ORF Vector (Mouse) (pORF)
ORF042286	ABM	1.0 ug DNA	EUR 95

CXCL1 ELISA Kit (Mouse) (OKAN04583)
OKAN04583	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL

CXCL1 ELISA Kit (Mouse) (OKBB00312)
OKBB00312	Aviva Systems Biology	96 Tests	EUR 544
Description: Description of target: Chemokine (C-X-C motif) ligand 1 (CXCL1) is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GROÎ±, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-Î±). In humans, this protein is encoded by the CXCL1 gene. The gene for CXCL1 is located on human chromosome 4 amongst genes for other CXC chemokines. The mature form of CXCL1 is maximally 73 amino acids long. CXCL1 is secreted by human melanoma cells, has mitogenic properties and is implicated in melanoma pathogenesis. CXCL1 is expressed by macrophages, neutrophils and epithelial cells, and has neutrophil chemoattractant activity. This chemokine elicits its effects by signaling through the chemokine receptor CXCR2.CXCL1 decreased the severity of multiple sclerosis and may offer a neuro-protective function. The standard product used in this kit is recombinant mouse CXCL1, consisting of 77 amino acids with the molecular mass of 8KDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml

CXCL1 ELISA Kit (Mouse) (OKCD05712)
OKCD05712	Aviva Systems Biology	96 Wells	EUR 609
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL

KC ELISA Kit (Mouse) : 96 Wells (OKAG00090)
OKAG00090	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 8 pg/mL

CXCL1 Conjugated Antibody
C33054	SAB	100ul	EUR 397

CXCL1 cloning plasmid
CSB-CL006239HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 324 Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag Show more
Description: A cloning plasmid for the CXCL1 gene.

CXCL1 Blocking Peptide
20-abx061039	Abbexa	EUR 286.00 EUR 425.00	1 mg 5 mg
Shipped within 5-10 working days.

Cxcl1 Polyclonal Antibody
A51950	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

CXCL1 Polyclonal Antibody
A51978	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CXCL1 Blocking Peptide
33R-7741	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502

CXCL1 antibody (HRP)
60R-2236	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CXCL1 antibody (HRP)

CXCL1 antibody (FITC)
60R-2237	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CXCL1 antibody (FITC)

CXCL1 antibody (biotin)
60R-2238	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CXCL1 antibody (biotin)

Recombinant Human CXCL1
P0109	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

pCMV-SPORT6-CXCL1
PVT13291	Lifescience Market	2 ug	EUR 391

GRO-alpha/CXCL1 (CHO-expressed), Mouse
HY-P7186	MedChemExpress	50ug	EUR 337

Mouse CXCL1 AssayLite Antibody (FITC Conjugate)
70027-05141	AssayPro	150 ug	EUR 428

Cxcl1 sgRNA CRISPR Lentivector set (Mouse)
K4368201	ABM	3 x 1.0 ug	EUR 339

Mouse Growth-regulated alpha protein (Cxcl1)
1-CSB-RP092174m	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 11.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli

Mouse CXCL1/GROÎ± ELISA kit (4X96T)
LF-EK50474	Abfrontier	4Ã—96T	EUR 2201

Rat CXCL1 shRNA Plasmid
20-abx986581	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CXCL1 ELISA Kit
ELA-E1210h	Lifescience Market	96 Tests	EUR 824

CXCL1 ELISA KIT\|Human
EF003720	Lifescience Market	96 Tests	EUR 689

GRO-alpha/CXCL1, Human
HY-P7187	MedChemExpress	10ug	EUR 268

Tagscelia kitchen kempton st new bedford celia kitzinger celia kitzinger york cia kids cia kids camp cia kids classes cia kids code cia kids cooking cia kids games cia kids gov cia kids page cia kids program cia kids zone cia kissing stent cla kids clakids.org cli kit clia citation clia kit clia ks clima kids turma da monica clima kissimmee clima kissimmee florida clio kids throwing rocks dna dna ancestry dna block dna bts dna doe project dna gacha life dna hr block dna hrblock login dna lyrics dna motoring dna painter dna productions dna replication dna song dna study slavery dna testing for ancestry dna testing kits dna tests dna.hrblock.com dnajlion7 youtube dnalion7 youtube test kits test kits cdc test kits contaminated test kits contaminated uk test kits contaminated with coronavirus test kits contaminated with covid-19 test kits contaminated with covid19 test kits fda test kits for baquacil pools test kits for covid-19 test kits for ionizer systems test kits for mdma test kits for meth test kits for mold test kits for molly test kits for nursing homes test kits for ph test kits ny test kits usa

Evaluation of RealStar Reverse Transcription-Polymerase Chain Reaction Kits

Analysis of RealStar Reverse Transcription-Polymerase Chain Response Kits for Filovirus Detection within the Laboratory and Area.

Human Cluster Of Differentiation (CD163) ELISA Kit

Human Cluster Of Differentiation (CD163) ELISA Kit

Human Cluster Of Differentiation (CD163) ELISA Kit

Human Cluster Of Differentiation (CD163) ELISA Kit

Anti-CD163

Anti-CD163

Anti-CD163

Anti-CD163

Anti-CD163

Anti-CD163

Anti-CD163

Anti-CD163

Mouse Cluster Of Differentiation (CD163) ELISA Kit

Mouse Cluster Of Differentiation (CD163) ELISA Kit

Rat Cluster Of Differentiation (CD163) ELISA Kit

Rat Cluster Of Differentiation (CD163) ELISA Kit

Mouse Cluster Of Differentiation (CD163) ELISA Kit

Mouse Cluster Of Differentiation (CD163) ELISA Kit

Rat Cluster Of Differentiation (CD163) ELISA Kit

Rat Cluster Of Differentiation (CD163) ELISA Kit

Mouse Cluster Of Differentiation (CD163) ELISA Kit

Mouse Cluster Of Differentiation (CD163) ELISA Kit

Rat Cluster Of Differentiation (CD163) ELISA Kit

Rat Cluster Of Differentiation (CD163) ELISA Kit

Anti-CD163 Antibody

Anti-CD163 Antibody

Anti-CD163 Antibody

Anti-CD163 Antibody

Anti-CD163 Antibody

Anti-CD163 antibody

Anti-CD163 antibody

Anti-CD163 antibody

Anti-CD163 antibody

Anti-CD163 antibody

Anti-CD163 antibody

Rabbit Polyclonal antibody Anti-CRBN

anti- CD163/M130 Antibody

Anti-CD163/M130 Antibody

Anti-Hu CD163 Purified

Anti-Hu CD163 Purified

Anti-Hu CD163 APC

Anti-Hu CD163 APC

Anti-Hu CD163 PE

Anti-Hu CD163 PE

Anti-CD163/M130 antibody

Anti-CD163 Antibody BIOTIN

Anti-CD163 Antibody FITC

Anti-CD163 Antibody BIOTIN

Anti-CD163 Antibody FITC

Human CD163 antigen(CD163)ISA kit

Human CD163 antigen(CD163)ISA kit

human CD163 antigen,CD163 LISA kit

Human CD163 antigen(CD163)ISA kit

Mouse Anti Human Cd163 Monoclonal Antibody

Mouse Anti Human Cd163 Monoclonal Antibody

Anti-CD163 Rabbit Monoclonal Antibody

Anti-Hu CD163 PE-Cy7

Anti-Hu CD163 PE-Cy7

Anti-Hu CD163 PerCP-Cy5.5

Anti-Hu CD163 PerCP-Cy5.5

Polyclonal Goat anti-GST α-form

Polyclonal Goat anti-GST μ-form

Polyclonal Goat anti-GST p-form

Porcine CD163 antigen,CD163 LISA kit

Porcine CD163 antigen,CD163 LISA kit

Canine CD163 antigen(CD163 LISA kit

Canine CD163 antigen(CD163 LISA kit

Mouse Anti Rat Cd163 Monoclonal Antibody

Mouse Anti Rat Cd163 Monoclonal Antibody

CD163 siRNA

CD163 siRNA

CD163 Antibody

CD163 Antibody

CD163 Antibody

CD163 Antibody

CD163 Antibody

CD163 antibody

CD163 antibody